4.3.3.3. Genotyping

See section (6.3.1) on microsatellite markers in the BEEBOOK paper on molecular methods (Evans et al., 2013) for the method to determine individual genotypes. The use of independent sets of tightly linked microsatellite markers (Shaibi et al., 2008, Table 15) to reconstruct queen genotypes from a sample of drones has been shown to result in a very high detection power (see section 4.3.3.5. on non-detection errors below), even allowing the identification of closely related queens (Jaffé et al., 2009a). For the details of the linked markers refer to Shaibi et al. (2008).

Table 15. Characteristics of the microsatellite DNA toolkit of Shaibi et al. (2008). DNA was Chelex-extracted (Walsh et al., 1991) from one leg of each bee. Multiplex PCR solutions contained 10 μl of 10–100 ng DNA, 1× PCR-Master-Mix (Promega), and 0.2 μm of each primer (5′-label). PCR programme: denaturation for 5 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s of annealing at 55 °C, extension for 1 min at 72 °C, final elongation of 20 min at 72 °C.

Locus

PCR

reaction

Primers sequence (5′–3′)

Repeat motif

HB-SEX-01

 

2

F: HEX-AGTGCAAAATCCAAATCATC

R: ATTCGATCACCCAAAGAA

(A)15

 

UN351

2

F: FAM-AGCATACTTCTTCACCGAACCAC

R: TCCGTTTATGCTTCATTTTCGA

(AT)13

HB-SEX-02

1

F: HEX-ACGCATTGAAGGATATTATGA

R: AATTTGAACATTCGATCACC

(A)16

HB-SEX-03

2

F: TET-AACGTGGAAGATAACTTTAACAA

R: ACAATGTTATGATTTTTCACGA

(TA)12

HB-THE-01

1

F: FAM-GACGATTTACGAGGTTTCAC

R: TCGATTTCGTTTCGTTTTAT

(TA)9

HB-THE-02

2

F: TET-GGGAAAGATATTAGGGAGGA

R: CGACGAAAAATTACAAGGAC

(TA)12

HB-THE-03

1

F: FAM-TAACTGGTCGTCGGTGTT

R: CACGTAGAGAATCCCATTGT

(TA)11 (TC)12

HB-THE-04

2

F: HEX-GCTGGAAGGGAACTGTAGA

R: GGACGCGTTTTAATATCTCA

(GA)9

HB-C16-01

2

F: HEX-AAAATGCGATTCTAATCTGG

R: TTGCCTAAAATGCTTGCTAT

(GA)35

AC006

1

F: TET-GATCGTGGAAACCGCGAC

R: CACGGCCTCGTAACGGTC

(TCT)5 (TTC)10

HB-C16-02

2

F: TET-TAGTATCGTGCTGTTCATCG

R: ACATACATCTCTTGGCGAGT

(TA)23

HB-C16-05

1

F: FAM-ATTTTATGCGCGTTTCGTA

R: CATGGCTCCTCCATTAAATC

(TC)23

A079

2

F: HEX-CGAAGGTTGCGGAGTCCTC

R: GTCGTCGGACCGATGCG

(CCT)10 (GA)10

AP043

2

F: TET-GGCGTGCACAGCTTATTCC

R: CGAAGGTGGTTTCAGGCC

(CT)24

A113

2

F: FAM-CTCGAATCGTGGCGTCC

R: CCTGTATTTTGCAACCTCGC

(TC)2,5,8,5

A024

1

F: TET-CACAAGTTCCAACAATGC

R: CACATTGAGGATGAGCG

(CT)10

A107

1

F: HEX-CCGTGGGAGGTTTATTGTCG

R: CCTTCGTAACGGATGACACC

(CT)23

A007

1

F: FAM-GTTAGTGCCCTCCTCTTGC

R: CCCTTCCTCTTTCATCTTCC

(CT)3 (T)7(CT)24

The BEEBOOK