1.2.2. Molecular methods

The Polymerase Chain Reaction (PCR) has increasingly been used for detection of microorganisms. The internal transcribed spacer (ITS) region of the nuclear ribosomal repeat unit is the locus most often used for molecular identification of fungal species (Nilsson et al., 2008) and it is now accepted as the general fungal barcode marker (Schoch et al., 2012). Almost no variation between A. apis strain was detected in the ITS region (Anderson et al., 1998; Jensen et al., 2012) and several A. apis species specific primers have been designed targeting the ITS (Table 1). Irrespective of which primers are used, the presence of a band from PCR amplification indicates the presence of A. apis DNA. 

DNA can be extracted with standard kits like DNeasy® Plant Mini Kit (Qiagen), Ultra Clean plant DNA isolation kits (Mo Bio Laboratories) or PrepMan Ultra reagent (Applied Biosystems) using the manufacturers’ protocols (for other protocols of DNA extractions consult the BEEBOOK paper on molecular methods (Evans et al., 2013)

Table 1. List of Ascosphaera apis specific primers. * Primer pair recommended to be used as standard.

Primer name

Annealing temp. (°C)

Primer sequence

Citation

3-F1*

62

TGTCTGTGCGGCTAGGTG

James and Skinner, 2005

3-F2

62

GGGTTCTCGCGAGCCTG

James and Skinner, 2005

3-R1*

62

CCACTAGAAGTAAATGATGGTTAGA

James and Skinner, 2005

AscoF3

64

GCACTCCCACCCTTGTCTA

Murray et al., 2005

AapisR3

64

CCCACTAGAAGTAAATGATGGTTA

Murray et al., 2005

 

1.2.2.1 PCR for species identification