1.4.2. PCR for strain differentiation

Genetic variation is crucial for strain differentiation, and the arms race in host-pathogen relationships has been recorded with genetically different A. apis strains (Vojvodic et al., 2011b). The PCR fingerprinting method, using BOX, REP, and ERIC as random primers (Reynaldi et al., 2003), has been used to identify A. apis isolates, and microsatellite markers have been developed (Rehner and Evans, 2009). Recently several sequences of intergenetic regions or introns were screened. Three loci were found to be highly variable and can be used in identifying and differentiating A. apis strains (Jensen et al., 2012) (Table 2). The advantages of DNA sequences of polymorphic loci with specific primers over the PCR fingerprinting and microsatellite markers is that the sequences produced in one study can easily be compared with those in another study.

Table 2.  List of primers for amplification of Ascosphaera apis polymorphic loci.

Primer name

Annealing temp. (°C)

Primer sequence

Citation

SCA300Aa-For1*

60

AGGAACCGCGTTTGTTGTAT

Jensen et al., 2012

SCA300Aa-Rev 1*

60

CTTCAAAGCCAGCTCCAGTC

Jensen et al., 2012

Ef1a-Aa-for1*

60

TCACAATGGGGTATGTTGCG

Jensen et al., 2012

Ef1a-Aa-Rev1*

60

GGAAGAGACCTCCTTGACGA

Jensen et al., 2012

Sca1635Aa-For1*

60

CGACAAGGCTGTCTTCATCA

Jensen et al., 2012

Sca1635Aa-Rev1*

60

AGCACTCTCGGTCTCGTTTC

Jensen et al., 2012

1.4.2.1. PCR