1.6.1. qRT-PCR for quantification of A. apis transcripts

  1. cDNA can be amplified in a 20 µl reaction containing,
    1.1. 1.0 U of GoTaq® Flexi DNA polymerase (Promega Co;
    Madison, WI),
    1.2. 5 x GoTaq® Flexi buffer,
    1.3. 0.25 mM dNTP mix,
    1.4. 2.5 mM MgCl2,
    1.5. 0.3 µM of each primer,
    1.6. 0.75 µl of a 1/1000 stock dilution of SYBR-Green (Invitrogen Corp),
    1.7. 1 µl of cDNA
  2. Reaction conditions are as follows:
    2.1. Initial denaturing at 95o C for 3 min,
    2.2. 40 cycles at 95oC (20 s), 58-62oC (30 s) depending on the gene (Table 3) and 72oC (30 s).
    Negative controls (all reaction components except the DNA which is replaced with water) must be included in each run.
  3. For standardization and normalization against housekeeping genes and data analysis, see the BEEBOOK paper on molecular methods (Evans et al., 2013).

Table 3. List of qRT-PCR primers developed for targeting A. apis transcripts. The first three primer sets target genes that are involved in fungal mating and reproduction. Actin can be used as a reference gene.

Primer name

Annealing temp. (°C)

Primer sequence

Citation

Mat1-2-1 F

62

AAAATACCAAGGCCACCGA

Aronstein et al., 2007

Mat1-2-1 R

62

GGAGCATATTGGTAATTTGG

Aronstein et al., 2007

Ste11-like F

62

GGGAAGATTGCCAGGCC

Aronstein et al., 2007

Ste11-like R

62

CAAACTTGTAGTCCGGATG

Aronstein et al., 2007

Htf F

62

AAAATCCCAAGGCCTCGTA

Aronstein et al., 2007

Htf R

62

CTGGTAGCGGTAGTCAGG

Aronstein et al., 2007

Actin_Aapis F

58

CATGATTGGTATGGGTCAG

Aronstein et al., 2007

Actin_Aapis R

58

CGTTGAAGGTCTCGAAGAC

Aronstein et al., 2007