2.3.2 Molecular methods

There is no single method (morphological, physiological or molecular) that can be used to recognize all of the approximately 250 Aspergillus species. Using a multi-locus approach will give a lot of information, but it also requires certain skills and equipment not always present in diagnostic laboratories (Geiser et al., 2007). A two-step barcoding has been suggested for identification of Aspergillus species in a clinical setting. The ITS regions can be used for inter-section level identification and the β-tubulin for identification of individual species within the various Aspergillus sections (Balajee et al., 2007) (see primers in Table 5).

Aspergillus DNA can, as for Ascosphaera, be extracted with standard kits (see also the BEEBOOK paper on molecular methods (Evans et al., 2013)

Table 5. List of primers used to be used in the two-step DNA barcoding of Aspergillus spp. for the ITS region and part of the β-tubulin gene.

Primer name

Annealing temp (°C)

Annealing temperature (°C)

Citation

ITS 1

55

TCCGTAGGTGAACCTGCGG

White et al., 1990

ITS 4

55

TCCTCCGCTTATTGATATGC

White et al., 1990

Bt2a (β-tubulin)

58

GGTAACCAAATCGGTGCTGCTTTC

Glass and Donaldson, 1995

Bt2b (β-tubulin)

58

ACCCTCAGTGTAGTGACCCTTGGC

Glass and Donaldson, 1995