2.2.2.3. Molecular detection of Nosema spp. (N. apis , N. ceranae and N. bombi)

In addition to the microscopic techniques described above, various molecular methods have been developed for the detection and identification of Nosema spp. because such molecular methods are more sensitive and species specific (Klee et al., 2006; 2007). As a consequence, it is possible to confirm the presence of Nosema (and other disease organisms) in bees using molecular techniques even when visual detection suggests its absence. Care must be exercised, though, in interpretation of results from molecular detection. Nosema may be detected molecularly in a bee, though very few spores are present in the bee and the pathogen has little or no impact on its host. In addition, vegetative forms of Nosema as well as spores can be detected using molecular methods, whereas only spores can be detected using visual methods. A further advantage of molecular methods, is that their extreme sensitivity of detection may provide insights into hitherto unknown modes of transmission of pathogens. 

The molecular techniques developed for detection of Nosema spp. in bees (i.e. N. apis, Nosema bombi, found to date only in bumble bees, and N. ceranae) are usually PCR-based (i.e. uniplex or multiplex PCR, PCR-RFLP, qPCR; see the BEEBOOK paper on molecular methods (Evans et al., 2013), and a wide range of species-specific PCR primer sets for these Nosema species can be found in the literature (Table 1). A test of the specificity and detection limits of nine of these primer sets suggests that some of them may lack specificity or exhibit low sensitivity (Erler et al., 2011). In addition, the use of different molecular methods or conditions across laboratories can lead to inconsistencies. For this reason, it is recommended that PCR-based screening protocols be optimized and adjusted to fit each individual laboratory’s conditions, research and monitoring questions. To allow comparisons across laboratories, we recommend analysis of the same homogenates of infected bees in each laboratory to account for differences in sensitivity, or for threshold sensitivities of detection to be reported per laboratory in terms of minimum number of spores per bee that can be detected by molecular markers.

Whilst most primers are designed for conventional PCR, real time PCR (qPCR or quantitative PCR, see the BEEBOOK paper on molecular methods (Evans et al., 2013)) primers and protocols for quantification of N. ceranae and N. apis have also been developed (Table 1), including primers that quantify both species in one reaction (Martín-Hernández et al., 2007). As for standard PCR, primer sets for qPCR need to be tested in each laboratory for sensitivity and reliability (see also Bourgeois et al., 2010; Burgher-MacLellan et al., 2010; Hamiduzzaman et al., 2010; Traver and Fell, 2012 and the molecular paper of BEEBOOK  by Evans et al., 2013).

Here we report the use of a multiplex PCR-based method that is able to detect and differentiate simultaneously the three Nosema species of high prevalence in European bee populations (N. apis, N. bombi and N. ceranae) using genomic DNA. Microsporidia from genera other than Nosema are known from bees, where they can be very abundant (see Paxton et al., 1997; Li et al., 2012). To capture all of these Microsporidia, it is advisable to PCR amplify microsporidian DNA using ‘generic’ primers (see Table 1) and then sequence PCR products, which can be laborious and expensive. Here we present a much faster and cheaper method in which we combined multiple primers based on the 16S ribosomal rRNA gene into a single reaction to simultaneously detect N. apis, N. bombi and N. ceranae in bees.

Table 1. List of primer sets available for the detection of Nosema spp. in bees by PCR.  

 

 

 

 

 

 

 

Fragment size (bp)

name

Source

 

 primer sequence (5´-3´)

locus

use

N.a.

N.b.

N.c.

218MITOC

Martín-Hernández et al. 2007

fwd

CGGCGACGATGTGATATGAAAATATTAA

SSU rRNA

qPCR

 

 

218-219

 

 

rev

CCCGGTCATTCTCAAACAAAAAACCG

 

 

 

 

 

321APIS

Martín-Hernández et al. 2007

fwd

GGGGGCATGTCTTTGACGTACTATGTA

SSU rRNA

qPCR

321

 

 

 

 

rev

GGGGGGCGTTTAAAATGTGAAACAACTATG

 

 

 

 

 

BOMBICAR

Plischuk et al. 2009

fwd

GGCCCATGCATGTTTTTGAAGATTATTAT

SSU rRNA

PCR

 

101

 

 

 

rev

CTACACTTTAACGTAGTTATCTGCGG

 

 

 

 

 

ITS

Klee et al. 2006

fwd

GATATAAGTCGTAACATGGTTGCT

ITS region

PCR

120

120

120

 

 

rev

CATCGTTATGGTATCCTATTGATC

 

 

 

 

 

N.b.a

Erler et al. 2011

fwd

TGCGGCTTAATTTGACTC

SSU rRNA/ITS

PCR

 

511

 

 

 

rev

GGGTAATGACATACAAACAAAC

 

 

 

 

 

Nbombi-SSU-J

Klee et al. 2006

fwd

CCATGCATGTTTTTGAAGATTATTAT

SSU rRNA

PCR

 

323

 

 

 

rev

CATATATTTTTAAAATATGAAACAATAA

 

 

 

 

 

NOS

Higes et al. 2006

fwd

TGCCGACGATGTGATATGAG

SSU rRNA

PCR

240

 

252

 

 

rev

CACAGCATCCATTGAAAACG

 

 

 

 

 

NosA

Webster et al. 2004

fwd

CCGACGATGTGATATGAGATG

SSU rRNA

PCR

209

 

 

 

 

rev

CACTATTATCATCCTCAGATCATA

 

 

 

 

 

SSU-res

Klee et al. 2007

fwd

GCCTGACGTAGACGCTATTC

SSU rRNA

PCR

402

402

402

 

 

rev

GTATTACCGCGGCTGCTGG

 

 

 

 

 

NaFor

Forsgren and Fries 2010

fwd(a)

CTAGTATATTTGAATATTTGTTTACAATGG b

LSU rRNA

qPCR

278

 

 

NcFor

 

fwd(c)

TATTGTAGAGAGGTGGGAGATT

 

 

 

 

316

UnivRev

 

Urev

GTCGCTATGATCGCTTGCC

 

 

 

 

 

Nosema

Chen et al. 2008

fwd

ggcagttatgggaagtaaca

SSU-rRNA

generic

208

 

212

 

 

rev

ggtcgtcacatttcatctct

 

 

 

 

 

N. ceranae

Chen et al. 2008

fwd

cggataaaagagtccgttacc

SSU-rRNA

PCR

 

 

250a

 

 

rev

tgagcagggttctagggat

 

 

 

 

 

N. apis

Chen et al. 2008

fwd

ccattgccggataagagagt

SSU-rRNA

PCR

401a

 

 

 

 

rev

cacgcattgctgcatcattgac

 

 

 

 

 

Nos-16S

Stevanovic et al. 2011

fwd

CGTAGACGCTATTCCCTAAGATT

SSU rRNA

PCR

488

 

488

 

 

rev

CTCCCAACTATACAGTACACCTCATA

 

 

 

 

 

Mnceranae-F

This report

fwd

CGTTAAAGTGTAGATAAGATGTT

SSU rRNA

PCR

 

 

 

Mnapis-F

 

fwd

GCATGTCTTTGACGTACTATG

 

 

 

 

143

Mnbombi-F

 

fwd

TTTATTTTATGTRYACMGCAG

 

 

 

171

 

Muniv-R

 

Urev

GACTTAGTAGCCGTCTCTC

 

 

224

 

 

SSUrRNA-f1b

 

 

Tay et al 2005

Ufwd

CACCAGGTTGATTCTGCCT

SSU rRNA

generic

 

ca. 545

 

SSUrRNA-r1b

 

Urev

TGTTCGTCCAGTCAGGGTCGTCA

 

 

 

 

 













ITS: internal transcribed spacer region; SSU: small subunit rRNA (16S rRNA); N.a.: Nosema apis; N.b.: Nosema bombi; N.c.: Nosema ceranae. aFragment size could not be verified. bSequence modified to complement original GenBank entry U97150.

Use: PCR, standard PCR (for the detection of different Nosema spp.); qPCR, for quantitative or real time PCR (for the quantification of different Nosema spp.) and standard PCR (for the detection of different Nosema spp.); generic, primers amplify all known Nosema spp. or all Microsporidia without differentiating among species.

2.2.2.3.3. Realtime PCR for quantification of N. apis and N. ceranae