3.4.4. Real-time PCR

  1. qPCR reactions are run in final volume of 10 µl using Platinum® qPCR SuperMix-UDG (Invitrogen-Life Technologies)
  2. Each reaction contains a final concentration of:
    - 1x qPCR SuperMix
    - 3.5 mM of Mg ions
    - 0.3µg of Bovine Serum Albumin (BSA)
    - 300nM each of forward and reverse primer (Table 3) and- 100nM of LNA probe (Table 3)
  3. The cycling conditions used are (as optimized in a BioRad CFX -BioRad Laboratories) - 50oC for 2 min (UDG incubation-single hold)
    - 95oC for 2 min (initial denaturation-single hold)
    And 35 cycles of:
    - 95oC for 10 sec (denaturation)
    - 59oC for 45 sec (anneal and extension)
    - Reading of signal at end of each cycle.

Note: The PCR competency and success of nucleic acid extracted from bees is assessed using the internal control real-time PCR assay which amplifies part of the 18s rRNA gene of A. mellifera  (Ward et al., 2007). The 18s real-time reactions were set-up and cycled as described for the A. woodi assay.

Table 3. Real-time PCR (qPCR). Sequence of primers and probe used for the detection of Acarapis woodi. Areas of sequences in bold (column 2) are non-complementary flaps; [+] Locked nucleic acid bases.

 

Primer/Probe name  

Sequence 5’-3’

Amplicon length  

aw_F1-flap

aataaatcataaTGATATCCCAATTATCTGAGTAATG

113 bp

aw_R3

AATATCTGTCATGAAGAATAATGTC

aw-LNAProbe

6FAM-ACC[+T]GT[+C]AA[+T]CC[+A]CCTAC-BHQ1